Stem-loop sequence gga-mir-96

AccessionMI0029336 (change log)
DescriptionGallus gallus miR-96 stem-loop
Literature search

6 open access papers mention gga-mir-96
(45 sentences)

Stem-loop
   ----------gg    cu         g     uu      --u  uu 
5'             cccg  uuggcacua cacau  uugcuu   gc  u
               ||||  ||||||||| |||||  ||||||   ||  a
3'             gggu  aaccgugau gugua  aacgag   ug  u
   agaggcggaaga    au         -     uu      uuu  ug 
Get sequence
Deep sequencing
485 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 844251-844336 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-96
gga-mir-183chr1: 844362-844459 [-]
gga-mir-96chr1: 844251-844336 [-]
gga-mir-182chr1: 843232-843313 [-]
Database links

Mature sequence gga-miR-96-5p

Accession MIMAT0037540
Sequence

9 - 

uuggcacuagcacauuuuugcu

 - 30

Get sequence
Deep sequencing485 reads, 5 experiments
Evidence experimental; Illumina [2]

Mature sequence gga-miR-96-3p

Accession MIMAT0037541
Sequence

50 - 

caauuauguguagugccaauau

 - 71

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).
2
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).