Stem-loop sequence gga-mir-92-2

AccessionMI0029335 (change log)
DescriptionGallus gallus miR-92-2 stem-loop
Literature search

17 open access papers mention gga-mir-92-2
(40 sentences)

Stem-loop
   -g        ug   g     uu  u   u     gua  u 
5'   uuccuccg  ggu gggau  gu gca uacuu   gc g
     ||||||||  ||| |||||  || ||| |||||   || u
3'   aaggaggu  ccg cccug  ca cgu augag   ug g
   ga        gu   g     uu  -   u     --a  u 
Get sequence
Deep sequencing
109630 reads, 1.44e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 3994560-3994640 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-92-2
gga-mir-106chr4: 3995151-3995231 [-]
gga-mir-18bchr4: 3995020-3995103 [-]
gga-mir-20bchr4: 3994839-3994923 [-]
gga-mir-19b-2chr4: 3994707-3994789 [-]
gga-mir-92-2chr4: 3994560-3994640 [-]
gga-mir-363chr4: 3994409-3994515 [-]
Database links

Mature sequence gga-miR-92-3p

Accession MIMAT0001109
Sequence

51 - 

uauugcacuugucccggccug

 - 71

Get sequence
Deep sequencing220017 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).