Stem-loop sequence gga-mir-33-2

AccessionMI0029334 (change log)
DescriptionGallus gallus miR-33-2 stem-loop
Literature search

8 open access papers mention gga-mir-33-2
(120 sentences)

Stem-loop
   -c         g   g     u    uu         gug  ag 
5'   ggcccucgc ggg ugcau guag  gcauugcau   uc  a
     ||||||||| ||| ||||| ||||  |||||||||   ||   
3'   cugggggcg ccc acgua cguc  cguaacgug   gg  c
   cc         g   g     c    cc         --a  gu 
Get sequence
Deep sequencing
37677 reads, 260 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr14: 4937943-4938029 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-33-2
gga-mir-1682chr14: 4947156-4947228 [+]
gga-mir-33-2chr14: 4937943-4938029 [-]
Database links

Mature sequence gga-miR-33-2-5p

Accession MIMAT0037539
Sequence

15 - 

gugcauuguaguugcauugcau

 - 36

Get sequence
Deep sequencing24999 reads, 5 experiments
Evidence not experimental

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).