Stem-loop sequence gga-mir-26a-2

AccessionMI0029333 (change log)
DescriptionGallus gallus miR-26a-2 stem-loop
Literature search

6 open access papers mention gga-mir-26a-2
(8 sentences)

Stem-loop
   ga   u   g     uu         c           -ug u 
5'   ggc ggc cuggg  caaguaauc aggauaggcug   g c
     ||| ||| |||||  ||||||||| |||||||||||   | u
3'   ccg ccg ggccu  guucauugg ucuuguccgac   c g
   --   c   a     cg         a           uga g 
Get sequence
Deep sequencing
848589 reads, 9.4e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr7: 22670544-22670629 [-]
intergenic
Database links

Mature sequence gga-miR-26a-2-5p

Accession MIMAT0037538
Sequence

16 - 

uucaaguaauccaggauaggcu

 - 37

Get sequence
Deep sequencing846496 reads, 5 experiments
Evidence not experimental

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).