Stem-loop sequence gga-mir-9-3

AccessionMI0029331 (change log)
DescriptionGallus gallus miR-9-3 stem-loop
Literature search

19 open access papers mention gga-mir-9-3
(327 sentences)

Stem-loop
   a   a        uc               g     gu   g 
5'  ggg uguuucug  uuugguuaucuagcu uauga  guu u
    ||| ||||||||  ||||||||||||||| |||||  |||  
3'  uuc guaaagau  aagccaauagaucga auacu  cga g
   c   a        ga               a     ac   g 
Get sequence
Deep sequencing
6238341 reads, 6.35e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr10: 12934122-12934207 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-9-3
gga-mir-9b-1chr10: 12934137-12934193 [+]
gga-mir-9-3chr10: 12934122-12934207 [-]
Database links

Mature sequence gga-miR-9-5p

Accession MIMAT0001195
Previous IDsgga-miR-9
Sequence

14 - 

ucuuugguuaucuagcuguauga

 - 36

Get sequence
Deep sequencing23818269 reads, 5 experiments
Evidence by similarity; MI0000466

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).