Stem-loop sequence bra-MIR158

AccessionMI0029320 (change log)
DescriptionBrassica rapa miR158 stem-loop
Gene family MIPF0000294; MIR158
Literature search

4 open access papers mention bra-MIR158
(14 sentences)

Stem-loop
   aua  -       aucu   cuu         u            -auu    a 
5'    gc acguuau    guu   cuuugucua cguuuggaaaag    gaug c
      || |||||||    |||   ||||||||| ||||||||||||    ||||  
3'    ug ugcagua    caa   gaaacagau guaaaccuuuuc    cuau g
   aga  c       gugc   aac         -            acau    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA8: 3271798-3271904 [+]
intergenic
Database links

Mature sequence bra-miR158-5p

Accession MIMAT0035701
Sequence

23 - 

cuuugucuaucguuuggaaaag

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR158-3p

Accession MIMAT0035702
Sequence

66 - 

uuuccaaauguagacaaagca

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1