Stem-loop sequence bra-MIR9569

AccessionMI0029319 (change log)
DescriptionBrassica rapa miR9569 stem-loop
Literature search

1 open access papers mention bra-MIR9569
(1 sentences)

Stem-loop
   cua     -   u                ca                 gguu               uc    g         a        auu 
5'    ucucc auu uaucuuucauuucacu  caauaaaaucauauauu    uugauaaaugaguua  auug ucuuguguc agauauac   g
      ||||| ||| ||||||||||||||||  |||||||||||||||||    |||||||||||||||  |||| ||||||||| ||||||||   u
3'    agagg uaa auagaaaguaaaguga  guuauuuuaguauguaa    aacuauuuacucaau  uaac aggacacag ucuauaug   u
   uac     g   u                aa                 aaau               ca    a         c        gcc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA3: 27699619-27699810 [-]
intergenic
Database links

Mature sequence bra-miR9569-5p

Accession MIMAT0035699
Sequence

60 - 

ugaguuaucauuggucuugug

 - 80

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR9569-3p

Accession MIMAT0035700
Sequence

111 - 

acacaggaacaauacuaacucauu

 - 134

Get sequence
Evidence experimental; Illumina [1]

References

1