Stem-loop sequence bra-MIR9567

AccessionMI0029316 (change log)
DescriptionBrassica rapa miR9567 stem-loop
Literature search

1 open access papers mention bra-MIR9567
(1 sentences)

Stem-loop
   auu              a                         ua                 --a  aa 
5'    aguuacgcaucuaa caacacauauaguuugcagggugga  aaacuggcauuauaugu   ac  g
      |||||||||||||| |||||||||||||||||||||||||  |||||||||||||||||   ||   
3'    ucaaugcguagauu guuguguauaucaaacgucccaccu  uuugaucguaauauaca   ug  a
   ggu              c                         ug                 aga  gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA3: 17824435-17824572 [+]
intergenic
Database links

Mature sequence bra-miR9567-5p

Accession MIMAT0035693
Sequence

15 - 

uaaacaacacauauaguuugc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR9567-3p

Accession MIMAT0035694
Sequence

106 - 

aaacuauauguguugcuuaga

 - 126

Get sequence
Evidence experimental; Illumina [1]

References

1