Stem-loop sequence bra-MIR408

AccessionMI0029311 (change log)
DescriptionBrassica rapa miR408 stem-loop
Gene family MIPF0000102; MIR408
Literature search

6 open access papers mention bra-MIR408
(13 sentences)

Stem-loop
   ugaaa     gaaaaaaaa   g     aua a  ga        c       g      u       aa   -----      caua   a 
5'      ggaga         aga aaggg   g aa  ggagggag cagggaa aggcag gcauggg  gag     accaaa    guc u
        |||||         ||| |||||   | ||  |||||||| ||||||| |||||| |||||||  |||     ||||||    |||  
3'      cuucu         ucu uuuuc   c uu  ucucucuc gucccuu uucguc cguaccu  cuc     ugguuu    uag u
   -uuua     ---------   g     -ac a  ag        u       g      u       aa   aaaaa      --ug   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA5: 364768-364935 [+]
intergenic
Database links

Mature sequence bra-miR408-5p

Accession MIMAT0035683
Sequence

41 - 

gggagccagggaagaggcagu

 - 61

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR408-3p

Accession MIMAT0035684
Sequence

121 - 

ugcuuguucccugucucucuc

 - 141

Get sequence
Evidence experimental; Illumina [1]

References

1