Stem-loop sequence bra-MIR9561

AccessionMI0029308 (change log)
DescriptionBrassica rapa miR9561 stem-loop
Literature search

1 open access papers mention bra-MIR9561
(1 sentences)

Stem-loop
   aau gc   c     c         c   cc                          cg u 
5'    g  cau cgcau ggugagucu uca  agucuuucacuaauuguauuaauauu  a u
      |  ||| ||||| ||||||||| |||  ||||||||||||||||||||||||||  |  
3'    c  gua gugua ccacucaga agu  ucagagagugguuaauauaauuauaa  u a
   aau uu   a     a         a   -c                          au a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA3: 13865321-13865443 [-]
intergenic
Database links

Mature sequence bra-miR9561-5p

Accession MIMAT0035677
Sequence

19 - 

ugagucucucaccagucuuucac

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR9561-3p

Accession MIMAT0035678
Sequence

86 - 

gagagacucugaaagacucacc

 - 107

Get sequence
Evidence experimental; Illumina [1]

References

1