Stem-loop sequence bra-MIR9560b

AccessionMI0029307 (change log)
DescriptionBrassica rapa miR9560b stem-loop
Gene family MIPF0002116; MIR9560
Literature search

1 open access papers mention bra-MIR9560b
(1 sentences)

Stem-loop
   acu         ua  c    -   u  a  ga    u        a           --------    ac 
5'    aucuuauuu  ag uuaa gug gu uu  cagg gguggaac aauaugaguuu        uuga  a
      |||||||||  || |||| ||| || ||  |||| |||||||| |||||||||||        ||||  u
3'    uagaauaag  uc aauu cac cg ag  gucc ccaucuug uuauacucaaa        aacu  u
   guu         --  u    a   c  a  uc    u        a           uuaaaaca    ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA6: 18161518-18161653 [+]
intergenic
Database links

Mature sequence bra-miR9560b-5p

Accession MIMAT0035675
Sequence

32 - 

acaggugguggaacaaauaugagu

 - 55

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR9560b-3p

Accession MIMAT0035676
Sequence

85 - 

ucauauuaguucuaccuccugcug

 - 108

Get sequence
Evidence experimental; Illumina [1]

References

1