Stem-loop sequence bra-MIR9560a

AccessionMI0029306 (change log)
DescriptionBrassica rapa miR9560a stem-loop
Gene family MIPF0002116; MIR9560
Literature search

1 open access papers mention bra-MIR9560a
(1 sentences)

Stem-loop
   uu         ga       -   u  a ug     u        a           g   --a  ag 
5'   aucuuauuu  agauuaa gug gu u  acagg gguggaac aauaugaguuu uau   gu  u
     |||||||||  ||||||| ||| || |  ||||| |||||||| ||||||||||| |||   ||   
3'   uagaauaag  ucuaauu cac cg a  ugucc ccaucuug uuauacucaaa gua   ca  c
   uu         --       a   c  a gu     u        a           -   aaa  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA9: 1983782-1983913 [+]
intergenic
Database links

Mature sequence bra-miR9560a-5p

Accession MIMAT0035673
Sequence

31 - 

acaggugguggaacaaauaugagu

 - 54

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR9560a-3p

Accession MIMAT0035674
Sequence

82 - 

ucauauuaguucuaccuccuguug

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1