Stem-loop sequence bra-MIR9559

AccessionMI0029305 (change log)
DescriptionBrassica rapa miR9559 stem-loop
Literature search

1 open access papers mention bra-MIR9559
(1 sentences)

Stem-loop
   g       c   c                 g           aaa     uug 
5'  aaucuuu ugu auuagguuuggauuuug ucauuguuggg   gguuc   a
    ||||||| ||| ||||||||||||||||| |||||||||||   |||||   a
3'  uuagaaa aca uaaucuaaaccuaaagc aguaacaaccu   ucaag   c
   g       a   u                 a           aaa     uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA4: 346426-346534 [+]
intergenic
Database links

Mature sequence bra-miR9559-5p

Accession MIMAT0035671
Sequence

20 - 

uuuggauuuuggucauuguug

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR9559-3p

Accession MIMAT0035672
Sequence

72 - 

acaaugaacgaaauccaaauc

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1