Stem-loop sequence bra-MIR9558

AccessionMI0029304 (change log)
DescriptionBrassica rapa miR9558 stem-loop
Literature search

1 open access papers mention bra-MIR9558
(2 sentences)

Stem-loop
   caa  ca          c    -                      gaaaugucacuugggugguguagguuc 
5'    ug  aacacugugg aaag agaugucuggcuugcaacaucu                           a
      ||  |||||||||| |||| ||||||||||||||||||||||                           g
3'    ac  uugugacacc uuuc uuuacagaccgaacguuguaga                           a
   cug  ac          c    c                      gauugucaucuacacuguuacaagugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA3: 16624842-16624987 [-]
intergenic
Database links

Mature sequence bra-miR9558-5p

Accession MIMAT0035669
Sequence

21 - 

agagaugucuggcuugcaaca

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR9558-3p

Accession MIMAT0035670
Sequence

107 - 

uugcaagccagacauuuccuuu

 - 128

Get sequence
Evidence experimental; Illumina [1]

References

1