Stem-loop sequence bra-MIR9557

AccessionMI0029303 (change log)
DescriptionBrassica rapa miR9557 stem-loop
Literature search

1 open access papers mention bra-MIR9557
(1 sentences)

Stem-loop
   gccgcuuuauucuucacuuacgcaugcugucuuuacaguucacacu                                 a    gaa ug aggaacaaaaaga g       aa 
5'                                               gauuuugcguuucaacucgguccucauuucuuu uaac   g  g             u uuuucag  g
                                                 ||||||||||||||||||||||||||||||||| ||||   |  |             | |||||||  a
3'                                               cuaaaacgcaagguugagucgggaguaaagaaa auug   c  c             g agaaguu  a
   -------------------------------------------uuu                                 -    -aa gu gaaaguaagagaa g       ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA7: 1046108-1046295 [-]
intergenic
Database links

Mature sequence bra-miR9557-5p

Accession MIMAT0035667
Sequence

49 - 

uuuugcguuucaacucggucc

 - 69

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR9557-3p

Accession MIMAT0035668
Sequence

165 - 

gcugaguuggaacgcaaaauc

 - 185

Get sequence
Evidence experimental; Illumina [1]

References

1