Stem-loop sequence bra-MIR9556

AccessionMI0029302 (change log)
DescriptionBrassica rapa miR9556 stem-loop
Literature search

1 open access papers mention bra-MIR9556
(1 sentences)

Stem-loop
   auu            u     ---uu        uuaua   -   u 
5'    gucaauugguga aguag     cuuaagcg     gug gau u
      |||||||||||| |||||     ||||||||     ||| |||  
3'    cgguuaaccacu ucauc     gaguucgu     cac cua c
   uuc            u     uuauu        --ugg   u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA7: 19158445-19158534 [-]
intergenic
Database links

Mature sequence bra-miR9556-5p

Accession MIMAT0035665
Sequence

4 - 

gucaauuggugauaguaguuc

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR9556-3p

Accession MIMAT0035666
Sequence

69 - 

ucuacuuucaccaauuggccu

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1