Stem-loop sequence bra-MIR9553

AccessionMI0029299 (change log)
DescriptionBrassica rapa miR9553 stem-loop
Literature search

1 open access papers mention bra-MIR9553
(1 sentences)

Stem-loop
   -----------------------------ggggcaaga   c           a     a    a            au    aucccauaauuagcuuauauuuugg 
5'                                       ggg aaccauguaca agcug agcu auuaugugaagu  ggua                         u
                                         ||| ||||||||||| ||||| |||| ||||||||||||  ||||                          
3'                                       ccc uugguacaugu ucgac ucga uaauacacuuca  ccgu                         a
   caugugucgcccucucuacgguuuguuucaccaucuua   -           a     c    c            gu    auauaaucuaagaucagaaucgguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA1: 7994267-7994454 [+]
intergenic
Database links

Mature sequence bra-miR9553-5p

Accession MIMAT0035659
Sequence

21 - 

uacaaagcugaagcuaauuaug

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR9553-3p

Accession MIMAT0035660
Sequence

121 - 

uaaucagcuccagcuauguaca

 - 142

Get sequence
Evidence experimental; Illumina [1]

References

1