Stem-loop sequence bra-MIR9552b

AccessionMI0029297 (change log)
DescriptionBrassica rapa miR9552b stem-loop
Gene family MIPF0002123; MIR9552
Literature search

1 open access papers mention bra-MIR9552b
(1 sentences)

Stem-loop
   ----------------------------------------------------------------------------------------------u                                                c                a  uc  c    
5'                                                                                                guuguugucaguagacuaucggucuacuuggucagcgcuagcuucuuc ucaccggacaggcuaa cu  ug agc 
                                                                                                  |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||  || || u
3'                                                                                                caacaacagucgucugauagccagaugagccagucgcgaucgaagaag aguggccugucugauu ga  ac ucu 
   aguucuuugucucggguaugcucugucauaugguucacuuucuuugugagcugauguagaagcugagacguuagcuucuguaauucuucaaccga                                                u                a  uc  c    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA8: 9143815-9144063 [-]
intergenic
Clustered miRNAs
< 10kb from bra-MIR9552b
bra-MIR9552achrA8: 9143909-9144122 [+]
bra-MIR9552bchrA8: 9143815-9144063 [-]
Database links

Mature sequence bra-miR9552b-5p

Accession MIMAT0035655
Sequence

17 - 

cuaucggucuacuuggucagc

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR9552b-3p

Accession MIMAT0035656
Sequence

121 - 

ugaccgaguagaccgauaguc

 - 141

Get sequence
Evidence experimental; Illumina [1]

References

1