Stem-loop sequence bra-MIR9552a

AccessionMI0029296 (change log)
DescriptionBrassica rapa miR9552a stem-loop
Gene family MIPF0002123; MIR9552
Literature search

1 open access papers mention bra-MIR9552a
(1 sentences)

Stem-loop
   -----------------------------------------------------------u           c                c                   a           a    ---   a ug a 
5'                                                             guuguugucag agacuaucggucuacu ggucagcgcuagcuucuuc ucaccggacag cuaa   ucu g  g g
                                                               ||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||| ||||   ||| |  | a
3'                                                             caacaacaguc ucugauagccagauga ccagucgcgaucgaagaag aguggccuguc gauu   aga c  c a
   cuuugugagccgcuguagaagcugagacgcuagcuucuguaauucuucaaccgacugcga           a                a                   g           c    uga   - gu g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA8: 9143909-9144122 [+]
intergenic
Clustered miRNAs
< 10kb from bra-MIR9552a
bra-MIR9552bchrA8: 9143815-9144063 [-]
bra-MIR9552achrA8: 9143909-9144122 [+]
Database links

Mature sequence bra-miR9552a-5p

Accession MIMAT0035653
Sequence

17 - 

cuaucggucuacucggucagc

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR9552a-3p

Accession MIMAT0035654
Sequence

121 - 

ugaccaaguagaccgauaguc

 - 141

Get sequence
Evidence experimental; Illumina [1]

References

1