Stem-loop sequence ath-MIR826b

AccessionMI0029231 (change log)
DescriptionArabidopsis thaliana miR826b stem-loop
Literature search

3 open access papers mention ath-MIR826b
(21 sentences)

Stem-loop
        g   a            c            acuuu   cagc 
5' uauga aua ucugguuuugga acgugaaaauua     uca    a
   ||||| ||| |||||||||||| ||||||||||||     |||    g
3' auacu uau aggccaaaaccu ugcacuuuuagu     agu    c
        a   c            a            ---au   auaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named MIR5090 in [1], but is unrelated to the human mir-5090 sequence (MI0017979).

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 1340521-1340614 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR826b
ath-MIR826bchr4: 1340521-1340614 [-]
ath-MIR826achr4: 1340479-1340656 [+]
Database links

Mature sequence ath-miR826b

Accession MIMAT0035543
Sequence

13 - 

ugguuuuggacacgugaaaau

 - 33

Get sequence
Evidence not experimental

References

1