Stem-loop sequence bma-mir-2h-2

AccessionMI0029227 (change log)
DescriptionBrugia malayi miR-2h-2 stem-loop
Literature search

3 open access papers mention bma-mir-2h-2
(32 sentences)

Stem-loop
   ------------      -aaaa   uaa  g   -a    u     c   --      -uugu a 
5'             uucccg     uac   ug agc  gucg aucga ucu  gauaug     c c
               ||||||     |||   || |||  |||| ||||| |||  ||||||     | a
3'             aggggc     aug   ac ucg  cagc uagcu aga  cuauac     g u
   acucaccguaau      cauag   uuc  g   aa    u     u   cg      ucuuu u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold153: 21047-21164 [-]
intergenic
Clustered miRNAs
< 10kb from bma-mir-2h-2
bma-mir-2fBmal_v3_scaffold153: 23624-23729 [-]
bma-mir-5839Bmal_v3_scaffold153: 22289-22393 [+]
bma-mir-2h-2Bmal_v3_scaffold153: 21047-21164 [-]
bma-mir-2h-1Bmal_v3_scaffold153: 18589-18706 [+]
bma-mir-2iBmal_v3_scaffold153: 16336-16445 [+]
bma-mir-36dBmal_v3_scaffold153: 16078-16186 [+]
bma-mir-2dBmal_v3_scaffold153: 15939-16048 [+]
Database links

Mature sequence bma-miR-2h-5p

Accession MIMAT0037529
Sequence

23 - 

agucguaucgacucugauau

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bma-miR-2h-3p

Accession MIMAT0037530
Sequence

62 - 

uaucgcagauucgauucgacaa

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).