Stem-loop sequence bma-mir-9534

AccessionMI0029225 (change log)
DescriptionBrugia malayi miR-9534 stem-loop
Literature search

1 open access papers mention bma-mir-9534
(1 sentences)

Stem-loop
   auugguaguaauacuu    a -u         c    ----      uuu    gagaa       gu 
5'                 guca g  gacaguuau uguu    auguua   uuug     gucgucu  u
                   |||| |  ||||||||| ||||    ||||||   ||||     |||||||   
3'                 uagu c  cugucaaua acaa    uacaau   aaau     cagcggg  u
   ----------auucuu    a uu         -    aggu      --u    -auaa       aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold259: 19365-19485 [+]
intergenic
Database links

Mature sequence bma-miR-9534

Accession MIMAT0037528
Sequence

38 - 

auguuauuuuuuggagaagucgu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).