Stem-loop sequence bma-mir-36a-3

AccessionMI0029191 (change log)
DescriptionBrugia malayi miR-36a-3 stem-loop
Literature search

1 open access papers mention bma-mir-36a-3
(9 sentences)

Stem-loop
   --------------      cuuca           g    u    u  uuaa 
5'               auggug     ggaugugcauc uggu gaug ag    a
                 ||||||     ||||||||||| |||| |||| ||    a
3'               uaccau     cuuacacgugg gcca cuac uc    a
   aacuuauaucguac      acugg           -    -    -  ucuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold337: 13509-13600 [+]
intergenic
Clustered miRNAs
< 10kb from bma-mir-36a-3
bma-mir-36a-3Bmal_v3_scaffold337: 13509-13600 [+]
bma-mir-36a-1Bmal_v3_scaffold337: 15957-16037 [+]
Database links

Mature sequence bma-miR-36a-3

Accession MIMAT0037491
Sequence

51 - 

ucaccgggugcacauucgguc

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).