Stem-loop sequence bma-mir-2f

AccessionMI0029190 (change log)
DescriptionBrugia malayi miR-2f stem-loop
Literature search

3 open access papers mention bma-mir-2f
(29 sentences)

Stem-loop
   -  uc   -  ug      a   -ca c       -a  -    c     guuug 
5'  uc  gaa ag  cgagug cag   g cguaucg  cu guga augau     a
    ||  ||| ||  |||||| |||   | |||||||  || |||| |||||      
3'  ag  cuu uc  guucau guc   c gcauagc  ga cacu uacug     u
   a  cc   a  gu      -   uac a       cc  a    a     ucuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold153: 23624-23729 [-]
intergenic
Clustered miRNAs
< 10kb from bma-mir-2f
bma-mir-2fBmal_v3_scaffold153: 23624-23729 [-]
bma-mir-5839Bmal_v3_scaffold153: 22289-22393 [+]
bma-mir-2h-2Bmal_v3_scaffold153: 21047-21164 [-]
bma-mir-2h-1Bmal_v3_scaffold153: 18589-18706 [+]
bma-mir-2iBmal_v3_scaffold153: 16336-16445 [+]
bma-mir-36dBmal_v3_scaffold153: 16078-16186 [+]
bma-mir-2dBmal_v3_scaffold153: 15939-16048 [+]
Database links

Mature sequence bma-miR-2f

Accession MIMAT0037490
Sequence

62 - 

uaucacaagcccgauacgaccau

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).