Stem-loop sequence bdi-MIR399c

AccessionMI0029163 (change log)
DescriptionBrachypodium distachyon miR399c stem-loop
Gene family MIPF0000015; MIR399
Literature search

3 open access papers mention bdi-MIR399c
(8 sentences)

Stem-loop
        c       c               -     a   -ac     --     guc    agguga   u  ag 
5' gaauc cagggcg uucuccuuuggcacg guggc ugu   cugca  augga   agcc      gga gc  g
   ||||| ||||||| ||||||||||||||| ||||| |||   |||||  |||||   ||||      ||| ||  u
3' cuuag gucccgu aagaggaaaccgugc ugccg acg   gacgu  ugccu   ucgg      ccu cg  g
        c       u               g     a   cuc     gg     ---    -----a   -  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 16765663-16765802 [+]
intergenic
Database links

Mature sequence bdi-miR399c

Accession MIMAT0035521
Sequence

114 - 

ugccaaaggagaauugcccug

 - 134

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).