Stem-loop sequence sly-MIR171e

AccessionMI0029125 (change log)
DescriptionSolanum lycopersicum miR171e stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

23 open access papers mention sly-MIR171e
(129 sentences)

Stem-loop
           uauauau                     ug   -g   u      aua 
5' uaggaaga       agauauugaugcgguucaauc  aaa  aca gguuag   u
   ||||||||       |||||||||||||||||||||  |||  ||| ||||||    
3' auccuucu       ucuauaacugcgccgaguuag  uuu  ugu ccgauu   g
           ------c                     gu   aa   u      aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr7: 60765650-60765756 [+]
intergenic
Database links

Mature sequence sly-miR171e

Accession MIMAT0035482
Sequence

80 - 

uugagccgcgucaauaucucu

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).