Stem-loop sequence sly-MIR169e

AccessionMI0029121 (change log)
DescriptionSolanum lycopersicum miR169e stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

16 open access papers mention sly-MIR169e
(47 sentences)

Stem-loop
   -a        -  c  u      auu         ucuauu    u   a          a      u     caaug   uuu   aa       u  au 
5'   ggaggaga gg cu acauga   agaagaguu      uguu agu gccaaggaug cuugcc uucau     ccu   gua  auggaaa ug  u
     |||||||| || || ||||||   |||||||||      |||| ||| |||||||||| |||||| |||||     |||   |||  ||||||| ||  a
3'   cuucuucu cc ga uguacu   ucuucucaa      acag uca cgguuucuac gaacgg gagua     ggg   uau  uaucuuu ac  c
   uc        a  u  u      guu         ------    u   g          -      u     --aaa   --u   gg       c  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr8: 57585442-57585633 [+]
intergenic
Database links

Mature sequence sly-miR169e-5p

Accession MIMAT0035475
Sequence

47 - 

uagccaaggaugacuugccuuu

 - 68

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sly-miR169e-3p

Accession MIMAT0035476
Sequence

132 - 

uggcaagcaucuuuggcgacu

 - 152

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).