Stem-loop sequence sly-MIR167b

AccessionMI0029112 (change log)
DescriptionSolanum lycopersicum miR167b stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

24 open access papers mention sly-MIR167b
(167 sentences)

Stem-loop
   ucucacuuc     -      uuuuu   a    a       c  c          aa    aaaauccuauua     c              auaaaaagaagaaaugaauuuaaauuugaauuuuuuguaaaaaaaaaauguugagguuuuu 
5'          uguau guuggu     gag gguu aagcugc ag augaucuggu  gaac            uauuu aucuauauuuucuu                                                             a
            ||||| ||||||     ||| |||| ||||||| || ||||||||||  ||||            ||||| ||||||||||||||                                                              
3'          acaua caacca     cuc cuaa uucgacg uc uacuggacua  cuug            auaga uagauauaaaagaa                                                             a
   aggaaacac     a      -----   a    c       a  -          -c    ------guuucg     -              guuucuuuauuuuaggaauguuuuuaaauuaaaagaaaaaaaguuuagguuuucuuccuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr2: 38817780-38818076 [-]
intergenic
Database links

Mature sequence sly-miR167b-5p

Accession MIMAT0035457
Sequence

33 - 

uaaagcugccagcaugaucugg

 - 54

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sly-miR167b-3p

Accession MIMAT0035458
Sequence

251 - 

aggucaucuagcagcuucaau

 - 271

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).