Stem-loop sequence sly-MIR156e

AccessionMI0029110 (change log)
DescriptionSolanum lycopersicum miR156e stem-loop
Gene family MIPF0000008; MIR156
Literature search

32 open access papers mention sly-MIR156e
(164 sentences)

Stem-loop
   u  u         -                    guu   uu     -    uu 
5'  gg ggugauaga agagagugagcacacauggu   uuc  gcaug augu  a
    || ||||||||| ||||||||||||||||||||   |||  ||||| ||||   
3'  cc ccacugucu ucucucauucguguguauca   aag  cguau uaua  u
   a  c         a                    ---   uu     a    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr8: 51945235-51945339 [-]
intergenic
Database links

Mature sequence sly-miR156e-5p

Accession MIMAT0035453
Sequence

7 - 

ugauagaagagagugagcac

 - 26

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sly-miR156e-3p

Accession MIMAT0035454
Sequence

81 - 

gcuuacucucuaucugucacc

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).