Stem-loop sequence sly-MIR156d

AccessionMI0029109 (change log)
DescriptionSolanum lycopersicum miR156d stem-loop
Gene family MIPF0000008; MIR156
Literature search

32 open access papers mention sly-MIR156d
(154 sentences)

Stem-loop
          --c    -       --aaaacaaag   c         -    -               cgu    u      -    uu 
5' cagaugc   uaaa aagggua           ggg ggugacaga agag agugagcacacaugg   uuuc ggcaug augu  a
   |||||||   |||| |||||||           ||| ||||||||| |||| |||||||||||||||   |||| |||||| ||||   
3' gucuaug   auuu uuucuau           ccc ccacugucu ucuc ucacucguguguauc   aaag ucguau uaua  u
          uau    c       cuccuuaacca   u         a    g               ---    u      a    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr8: 51913686-51913852 [-]
intergenic
Database links

Mature sequence sly-miR156d-5p

Accession MIMAT0035451
Sequence

35 - 

ugacagaagagagugagcac

 - 54

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sly-miR156d-3p

Accession MIMAT0035452
Sequence

109 - 

gcucacugcucuaucugucacc

 - 130

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).