Stem-loop sequence sly-MIR166c

AccessionMI0029105 (change log)
DescriptionSolanum lycopersicum miR166c stem-loop
Gene family MIPF0000004; MIR166
Literature search

25 open access papers mention sly-MIR166c
(91 sentences)

Stem-loop
   u   --u    ---uga              uu      cu    a aa       auuguauguauuuaguuauucguuaucaagauugauguc 
5'  gug   gugg      guuugagggggaug  gucugg  cgac c  uuacucu                                       g
    |||   ||||      ||||||||||||||  ||||||  |||| |  |||||||                                       a
3'  cau   cauc      caaacucuccuuac  cggacc  gcug g  aaugagg                                       u
   a   uuu    uuauaa              uu      ag    c ga       gaaaaauguagaacauauauacacaaauuaaauaagcaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr1: 92621085-92621272 [-]
intergenic
Database links

Mature sequence sly-miR166c-5p

Accession MIMAT0035443
Sequence

21 - 

gggauguugucuggcucgaca

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sly-miR166c-3p

Accession MIMAT0035444
Sequence

145 - 

ucggaccaggcuucauuccuc

 - 165

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).