Stem-loop sequence sly-MIR403

AccessionMI0029100 (change log)
DescriptionSolanum lycopersicum miR403 stem-loop
Gene family MIPF0000290; MIR403
Literature search

7 open access papers mention sly-MIR403
(24 sentences)

Stem-loop
         ug  aau  ------       g      ucac                 ----   ---  -uc     a 
5' agaaau  aa   ca      ggaagag cauauu    guuugugcgugaaucua    aca   ac   uuuuc u
   ||||||  ||   ||      ||||||| ||||||    |||||||||||||||||    |||   ||   |||||  
3' ucuuua  uu   gu      ccuuuuc guauaa    cgaacacgcacuuagau    ugu   ug   aaaag c
         gu  cgc  cucuaa       g      ugcu                 cguu   uau  uca     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr1: 78368928-78369069 [+]
intergenic
Database links

Mature sequence sly-miR403-5p

Accession MIMAT0035433
Sequence

33 - 

cguuugugcgugaaucuaaca

 - 53

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sly-miR403-3p

Accession MIMAT0035434
Sequence

86 - 

cuagauucacgcacaagcucg

 - 106

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).