Stem-loop sequence bol-MIR9411

AccessionMI0029005 (change log)
DescriptionBrassica oleracea miR9411 stem-loop
Literature search

2 open access papers mention bol-MIR9411
(3 sentences)

Stem-loop
   a    a          a              g     caaaau     u 
5'  ccug gacgacuucc uguaagucgucuag uauaa      auuga u
    |||| |||||||||| |||||||||||||| |||||      ||||| u
3'  ggac cugcugaagg acauucagcagguc auauu      uaauu u
   a    -          c              -     -----u     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bol-miR9411

Accession MIMAT0035366
Sequence

63 - 

uacuggacgacuuacacggaag

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24245539 "High-throughput sequencing identification of novel and conserved miRNAs in the Brassica oleracea leaves" Lukasik A, Pietrykowska H, Paczek L, Szweykowska-Kulinska Z, Zielenkiewicz P BMC Genomics. 14:801(2013).