Stem-loop sequence bol-MIR9410

AccessionMI0029004 (change log)
DescriptionBrassica oleracea miR9410 stem-loop
Literature search

2 open access papers mention bol-MIR9410
(2 sentences)

Stem-loop
   -    c     u     auua                   a   a  cg 
5'  cuuu cagac acuua    uaagucgucuggaaagucu cua gu  u
    |||| ||||| |||||    ||||||||||||||||||| ||| ||   
3'  gaag gucug ugaau    auucagcagacuuuucaga ggu cg  c
   u    c     c     auua                   a   -  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bol-miR9410

Accession MIMAT0035365
Sequence

11 - 

uacuuaauuauaagucgucugg

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24245539 "High-throughput sequencing identification of novel and conserved miRNAs in the Brassica oleracea leaves" Lukasik A, Pietrykowska H, Paczek L, Szweykowska-Kulinska Z, Zielenkiewicz P BMC Genomics. 14:801(2013).