Stem-loop sequence bol-MIR9409

AccessionMI0029003 (change log)
DescriptionBrassica oleracea miR9409 stem-loop
Literature search

2 open access papers mention bol-MIR9409
(3 sentences)

Stem-loop
   a       u  a     a               ---u   a      - ua 
5'  aaauaga ug aaaau cagucaugaacaaaa    aaa auuacu c  u
    ||||||| || ||||| |||||||||||||||    ||| |||||| |  a
3'  uuuaucu au uuuua gucaguacuuguuuu    uuu uaauga g  u
   -       c  c     c               uucu   g      c ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bol-miR9409

Accession MIMAT0035364
Sequence

69 - 

uuuuguucaugacugcauuuuc

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24245539 "High-throughput sequencing identification of novel and conserved miRNAs in the Brassica oleracea leaves" Lukasik A, Pietrykowska H, Paczek L, Szweykowska-Kulinska Z, Zielenkiewicz P BMC Genomics. 14:801(2013).