Stem-loop sequence gsa-mir-1175

AccessionMI0028946 (change log)
DescriptionGyrodactylus salaris miR-1175 stem-loop
Stem-loop
   ---      -         a     u  uucacg 
5'    gucgga aaguugaau ucgaa ug      a
      |||||| ||||||||| ||||| ||       
3'    cagcuu uucaacuua aguuu au      u
   agu      c         g     u  ucucuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gsa-miR-1175-5p

Accession MIMAT0035254
Sequence

1 - 

gucggaaaguugaauaucgaa

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gsa-miR-1175-3p

Accession MIMAT0035255
Sequence

44 - 

ugagauucaacuucuucgacuga

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24025793 "Substantial loss of conserved and gain of novel MicroRNA families in flatworms" Fromm B, Worren MM, Hahn C, Hovig E, Bachmann L Mol Biol Evol. 30:2619-2628(2013).