Stem-loop sequence efu-mir-504

AccessionMI0028916 (change log)
DescriptionEptesicus fuscus miR-504 stem-loop
Gene family MIPF0000437; mir-504
Stem-loop
   -ug    -            g     a    -aucu  au 
5'    cugu ugggagacccug ucugc cucu     gu  g
      |||| |||||||||||| ||||| ||||     ||   
3'    gaca acccuuugggac ggacg gagg     ca  c
   gga    u            g     c    gaaau  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977828.1: 1328093-1328171 [-]
intergenic
Database links

Mature sequence efu-miR-504

Accession MIMAT0035199
Sequence

11 - 

agacccuggucugcacucuaucugu

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).