Stem-loop sequence efu-mir-16-2

AccessionMI0028901 (change log)
DescriptionEptesicus fuscus miR-16-2 stem-loop
Gene family MIPF0000006; mir-15
Literature search

1 open access papers mention efu-mir-16-2
(1 sentences)

Stem-loop
   --   uc    cu         ua        c  --    aa 
5'   ugu  cgcu  agcagcacg  aauauugg gu  agug  a
     |||  ||||  |||||||||  |||||||| ||  ||||  u
3'   aca  gcga  ucgucgugu  uuauaacc ca  uuac  a
   gg   gu    uu         ua        a  aa    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977627.1: 6223011-6223095 [+]
intergenic
Clustered miRNAs
< 10kb from efu-mir-16-2
efu-mir-15JH977627.1: 6222869-6222948 [+]
efu-mir-16-2JH977627.1: 6223011-6223095 [+]
Database links

Mature sequence efu-miR-16

Accession MIMAT0035087
Sequence

11 - 

uagcagcacguaaauauuggcgu

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).