Stem-loop sequence efu-mir-29b

AccessionMI0028885 (change log)
DescriptionEptesicus fuscus miR-29b stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   -           -          u      gu      uuaaa 
5'  uuccucaggaa gcugguuuca auggug  uuagau     u
    ||||||||||| |||||||||| ||||||  ||||||     a
3'  aagggguucuu ugacuaaagu uaccac  gaucug     g
   g           g          u      --      uuagu 
Get sequence
Deep sequencing
1 reads, 1.3e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977672.1: 9214960-9215044 [+]
intergenic
Clustered miRNAs
< 10kb from efu-mir-29b
efu-mir-29bJH977672.1: 9214960-9215044 [+]
efu-mir-29aJH977672.1: 9215303-9215384 [+]
Database links

Mature sequence efu-miR-29b

Accession MIMAT0035175
Sequence

52 - 

cuagcaccauuugaaaucaguguu

 - 75

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).