Stem-loop sequence efu-mir-93

AccessionMI0028873 (change log)
DescriptionEptesicus fuscus miR-93 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   --   g       -ca       -     u    g   u  g u 
5'   ccu ggggcuc   aagugcu guucg gcag uag gu a u
     ||| |||||||   ||||||| ||||| |||| ||| || | a
3'   ggg ccccgag   uucacga cgagu cguc auc ca u c
   ua   a       ccc       u     -    -   -  g c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977625.1: 7045012-7045095 [-]
intergenic
Clustered miRNAs
< 10kb from efu-mir-93
efu-mir-106JH977625.1: 7045231-7045313 [-]
efu-mir-93JH977625.1: 7045012-7045095 [-]
efu-mir-25JH977625.1: 7044806-7044889 [-]
Database links

Mature sequence efu-miR-93

Accession MIMAT0035165
Sequence

11 - 

ccaaagugcuguucgugcagguagu

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).