Stem-loop sequence efu-mir-106

AccessionMI0028872 (change log)
DescriptionEptesicus fuscus miR-106 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   --           -ua       g       agaua    uc u 
5'   ccugcuggggc   aagugcu acagugc     gugg  c c
     |||||||||||   ||||||| |||||||     ||||  |  
3'   ggacgaccucg   uucaugg ugucacg     cauc  g u
   cg           ucg       g       ----c    gu c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977625.1: 7045231-7045313 [-]
intergenic
Clustered miRNAs
< 10kb from efu-mir-106
efu-mir-106JH977625.1: 7045231-7045313 [-]
efu-mir-93JH977625.1: 7045012-7045095 [-]
efu-mir-25JH977625.1: 7044806-7044889 [-]
Database links

Mature sequence efu-miR-106

Accession MIMAT0035164
Sequence

49 - 

uaccgcacuguggguacuugcugcu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).