Stem-loop sequence efu-mir-194-2

AccessionMI0028864 (change log)
DescriptionEptesicus fuscus miR-194-2 stem-loop
Gene family MIPF0000055; mir-194
Stem-loop
   --ug       cu         a      g     - u c 
5'     ccacccc  guaacagca cuccau uggaa g g c
       |||||||  ||||||||| |||||| ||||| | |  
3'     ggugggg  uauugucgu ggggug accuu c c c
   cggg       uc         c      -     g u g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977826.1: 1052832-1052909 [-]
intergenic
Clustered miRNAs
< 10kb from efu-mir-194-2
efu-mir-194-2JH977826.1: 1052832-1052909 [-]
efu-mir-192JH977826.1: 1052626-1052710 [-]
Database links

Mature sequence efu-miR-194

Accession MIMAT0034924
Sequence

11 - 

uguaacagcaacuccaugugga

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).