Stem-loop sequence efu-mir-331

AccessionMI0028853 (change log)
DescriptionEptesicus fuscus miR-331 stem-loop
Gene family MIPF0000199; mir-331
Stem-loop
   --       u        u    u       au ccaga 
5'   uuggguu guucuagg augg cccaggg  c     u
     ||||||| |||||||| |||| |||||||  |     c
3'   aauccaa caagaucc uauc ggguccc  g     a
   ca       c        -    c       cg accaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977638.1: 15533534-15533611 [-]
intergenic
Database links

Mature sequence efu-miR-331

Accession MIMAT0035148
Sequence

47 - 

gccccugggccuauccuagaac

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).