Stem-loop sequence efu-mir-181d

AccessionMI0028835 (change log)
DescriptionEptesicus fuscus miR-181d stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   ---       auca         g ug          guga  a g 
5'    agucaca    acauucauu u  ucgguggguu    gg c g
      |||||||    ||||||||| |  ||||||||||    || |  
3'    ucggugu    uguaaguag g  agccacccag    cc g a
   ggg       -cac         g --          ---a  - g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977789.1: 1151535-1151618 [-]
intergenic
Clustered miRNAs
< 10kb from efu-mir-181d
efu-mir-181cJH977789.1: 1151710-1151790 [-]
efu-mir-181dJH977789.1: 1151535-1151618 [-]
Database links

Mature sequence efu-miR-181d

Accession MIMAT0035133
Sequence

11 - 

aacauucauuguugucgguggguu

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).