Stem-loop sequence efu-mir-196

AccessionMI0028821 (change log)
DescriptionEptesicus fuscus miR-196 stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
   --auc                  a          a ug   
5'      uguggcuuagguaguuuc uguuguuggg u  ag 
        |||||||||||||||||| |||||||||| |  | u
3'      acauugaguccgucaaag acaacggcuc a  uu 
   ugacu                  a          a gu   
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977623.1: 30451063-30451141 [+]
intergenic
Database links

Mature sequence efu-miR-196

Accession MIMAT0035121
Sequence

11 - 

uagguaguuucauguuguuggga

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).