Stem-loop sequence efu-mir-455

AccessionMI0028777 (change log)
DescriptionEptesicus fuscus miR-455 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
   -   -  c ug  g          u      a   c   gaa 
5'  ccu gg g  ag guaugugccu uggacu cau gug   g
    ||| || |  || |||||||||| |||||| ||| |||    
3'  gga cu c  uc cauauacggg accuga gua cac   c
   c   a  c gu  a          u      c   c   gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977726.1: 91956-92039 [-]
intergenic
Database links

Mature sequence efu-miR-455

Accession MIMAT0035085
Sequence

50 - 

augcaguccaugggcauauacacuu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).