Stem-loop sequence efu-mir-361

AccessionMI0028745 (change log)
DescriptionEptesicus fuscus miR-361 stem-loop
Gene family MIPF0000172; mir-361
Stem-loop
   --auuu      uu         --u  a    u    auaa 
5'       gggagc  aucagaauc   cc gggg acuu    u
         ||||||  |||||||||   || |||| ||||    u
3'       ccuucg  uagucuuag   gg cccc ugaa    u
   ccucuu      uu         ugu  a    c    aaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977843.1: 1113020-1113102 [+]
intergenic
Database links

Mature sequence efu-miR-361

Accession MIMAT0035058
Sequence

11 - 

uuaucagaaucuccagggguac

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).