Stem-loop sequence efu-mir-181a

AccessionMI0028741 (change log)
DescriptionEptesicus fuscus miR-181a stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   --u   uc  u a   u      cu       ag     agu 
5'    gcu  ag g aca ucaacg  gucggug  uuugg   u
      |||  || | ||| ||||||  |||||||  |||||    
3'    cgg  uc c ugu aguugc  cagcuac  aaacu   a
   aau   ua  c a   u      --       ca     gaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH978090.1: 123043-123124 [+]
intergenic
Clustered miRNAs
< 10kb from efu-mir-181a
efu-mir-181aJH978090.1: 123043-123124 [+]
efu-mir-181bJH978090.1: 123304-123383 [+]
Database links

Mature sequence efu-miR-181a

Accession MIMAT0035054
Sequence

50 - 

aaccaucgaccguugauuguacc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).