Stem-loop sequence efu-mir-34c

AccessionMI0028730 (change log)
DescriptionEptesicus fuscus miR-34c stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   --     ag     a   a          c      c  a 
5'   agucu  uuacu ggc guguaguuag ugauug ua u
     |||||  ||||| ||| |||||||||| |||||| ||  
3'   uuaga  aauga ccg cacaucaauc acuaac au a
   gu     aa     a   g          -      c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977889.1: 780248-780326 [+]
intergenic
Clustered miRNAs
< 10kb from efu-mir-34c
efu-mir-34bJH977889.1: 779590-779671 [+]
efu-mir-34cJH977889.1: 780248-780326 [+]
Database links

Mature sequence efu-miR-34c

Accession MIMAT0035046
Sequence

46 - 

aaucacuaacuacacggccaagua

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).