Stem-loop sequence efu-mir-146

AccessionMI0028705 (change log)
DescriptionEptesicus fuscus miR-146 stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   -  -  u   u  g        a    a    cu  ga  u 
5'  ca cc ggc cu agaacuga uucc uagg  gu  gc c
    || || ||| || |||||||| |||| ||||  ||  ||  
3'  gu gg ccg gg ucuugacu aggg aucc  ua  cg u
   u  c  c   u  -        c    -    cg  aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977636.1: 5973083-5973162 [+]
intergenic
Database links

Mature sequence efu-miR-146

Accession MIMAT0035020
Sequence

48 - 

ugcccuagggacucaguucuggu

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).